Mature to sh (m2sh)

 1. Sequence  
Sequence of mature microRNA:
0 nucleotides typed in yet.
Help
 
    
    

 2. Optional parameters   Introduce missmatch for Drosha.
 
Position of mature
 
Print pcr oligos.
 
Change the head sequence to
 
Change the tail sequence to
 
Change the loop sequence to
 
Change PCR5' Enzyme seq
user specified 5' end of 5' primer for PCR. Default is CAGAAGGCTCGAGAAGGTATAT (XHO1)
 
Change PCR3' Enzyme seq
user specified 5' end of 3' primer for PCR. Default is CTAAAGTAGCCCCTTGAAT (ECOR1)